Stick Nodes

Stick Nodes®

A stickfigure animation app created for mobile devices!

Create your own stickman animations on your Android or iOS device!

Create a Profile

Community / Profile

  • Community Activity
  • Community Members
  • Community Groups
  • Log In
  • Register

Recent Activity

  • Profile Photoeggbasket12@eggbasketthats a complicated name, i'd just say "Menlo Correctional... [More»]5 minutes ago
  • Profile PhotoLordryptozillarex@ashtonzilla1945ALR dude my current admins will stay admins [More»]1 hour ago
  • Profile PhotoWannabe Outlaw@iamaBarry Lindon would like a word with you. [More»]1 hour ago
  • Profile Photonoirangel@noirangelevery day it doesn't happen it gets closer [More»]2 hours ago
  • Profile PhotoBeanBag0531@beanbag [More»]2 hours ago

Pages

  • About Us
  • Animation Spotlights
  • Christmas Banners
    • December 1
    • December 10
    • December 11
    • December 12
    • December 13
    • December 14
    • December 15
    • December 16
    • December 17
    • December 18
    • December 19
    • December 2
    • December 20
    • December 21
    • December 22
    • December 23
    • December 24
    • December 25
    • December 26
    • December 27
    • December 28
    • December 29
    • December 3
    • December 30
    • December 31
    • December 4
    • December 5
    • December 6
    • December 7
    • December 8
    • December 9
    • November 27
    • November 28
    • November 29
    • November 30
  • FAQs
  • Polls Archive
  • Roles and Badges
  • Stickfigures
    • Backgrounds
    • Effects
    • Miscellaneous
    • Objects
    • Packs
    • People
    • Vehicles
    • Weapons
  • Submit Thumbnail
  • Tutorials
  • Stick Nodes Twitter
  • Stick Nodes Facebook
  • Stick Nodes Youtube
  • Stick Nodes Reddit

Recent Comments

  • Amator(Guest)Madness Combat Head and Body PackMadness Combat Head and Body PackGod [More»]2 hours ago
  • πŸ₯šyolky slime🍳(Guest)Small Monsters Pack 2Small Monsters Pack 2Also SERIOUS PROPS bro you're AMAZING at making figures. [More»]2 hours ago
  • πŸ₯šyolky slime🍳(Guest)Small Monsters Pack 2Small Monsters Pack 2I saw the thumbnail and it was the thumbnail I made so i think it put... [More»]2 hours ago
  • Mr funni(Guest)Skeleton MovieclipSkeleton MovieclipGuys did you see that... [More»]3 hours ago
  • Profile PhotoDennisB@denniswdb2016Goldbeard Ceadeus MovieclipGoldbeard Ceadeus MovieclipCan I edit this to make the normal ceadeus and a baby ceadeus? [More»]5 hours ago

Who’s Online?

There are 668 users online now.

eggbasket12MoonMakesStuffPeso AnimationsMelonstastegood

(And 599 guests)

Most users online was 7115 on:
Thu May 28th, 2026 @ 9:23am




  • Thragg VS Satoru Gojo | JJK x Invincible
    • Star Pending
    • Star Pending
    • Star Pending
    • Star Pending
    • Star Pending
    4
    Youtube

    Thragg VS Satoru Gojo | JJK x Invincible

    By Sonic Yash · Spotlighted on Jun 15th

    Looksmaxxing death battle: Facial Hair vs Blue Eyes

  • Sonic The Hedgehog Vs Satoru Gojo
    • Star Filled
    • Star Filled
    • Star Filled
    • Star Filled
    • Star Half
    21
    Youtube

    Sonic The Hedgehog Vs Satoru Gojo

    By Sonic Yash · Spotlighted on Jun 12th

    For more animation please subscribe to the channel

  • Tournament – Corroded Body And Mind (Evil Versions)
    • Star Filled
    • Star Filled
    • Star Filled
    • Star Filled
    • Star Half
    5
    Youtube

    Tournament – Corroded Body And Mind (Evil Versions)

    By Rei Arthur Animation · Spotlighted on Jun 8th

    A tournament featuring various villainous characters from anime, movies, and comics.

  • Unknown Vs Everyone – 20K Special: Part 5
    • Star Filled
    • Star Filled
    • Star Filled
    • Star Filled
    • Star Half
    3
    Youtube

    Unknown Vs Everyone – 20K Special: Part 5

    By Cloudy 1 · Spotlighted on Jun 5th

    Sorry this part took so long, I had two other projects in between this one and part four. (Combat Gods x, and Goku vs Gohan)
    Pretty nervous releasing this ngl, I hope you guys like it. I put a lot of thought into putting it all together.
    I’m gonna work on part 6 straight away. No in-betweens.
    Thanks for all the support, love u guys.

The Creature

Profile picture of The Creature
My stickfigures

@thecreature34217

Last active: Active 3 hours, 57 minutes ago
Hi, welcome to my profile! here’s some info about me; I am a level 1 on the spectrum, I have adhd, I’ve been using sticknodes since 2021(?), and I easily forget things, so if I don’t do something I said I would, please remind me, I completely forgot.
occiferOcciferfeatured-lvl1Featured Lvl1uc-winner-lvl2UC Winner Lvl2pro-noderPro Noder (25+)

Joined on April 29th, 2025, this user has been a member for 414 days and is the 256,484th person to register an account.

Has 25 submissions, the first one uploaded on May 11th, 2025 and the most recent on June 16th, 2026.

Of those, 3 have been featured and 6 have won Users' Choice.

On average, each submission earns 2,100 downloads.
In total, they have been download 52,520 times.

Counting every individual stickfigure, including the contents of all packs, this user has technically made and submitted 25 stickfigures.

On average, when this user rates stickfigures, they are 85% positive.
Also, they are typically 100% positive when rating animation spotlights.

Has made 230 comments on non-activity pages of the site. Alternatively, this user has made 6,022 comments on actual activity pages of the site.

They have visited the site consecutively for 416 days, their best streak also being 416 days. On average, they post 35 updates and 81 comments per week.

This member is not a Users' Choice voter.

Show More
My Managed Groups (48)
  • Profile PhotoThrowaway groupOwner
  • Profile PhotoCardboard boxOwner
  • Profile PhotoSN Labs: ForgottenOwner
  • Profile PhotoThe Factory With No ExitsOwner
  • Profile PhotoSN labs Behind The ScenesOwner
  • Profile PhotoSN labs Testing GroundsOwner
  • Profile PhotoSN LabsOwner
  • Profile PhotoSN:ITC legit real leaksOwner
  • Profile PhotoNVCF.A Behind The ScenesOwner
  • Profile PhotoNPC_VIEWCAM_FEED.AVIOwner
  • Profile PhotoThe sink menOwner
  • Profile PhotoTheCreatures gmod rendersOwner
  • Profile PhotoBanLandOwner
  • Profile Photothe voidOwner
  • Profile PhototheCreatures pet placeOwner
  • Profile PhotoGumbuspostingOwner
  • Profile PhotoAd documentationOwner
  • Profile PhotoGuess the character!Owner
  • Profile PhotoREC.LOGSOwner
  • Profile PhotoOC landOwner
  • Profile PhotoPortal fanclubOwner
  • Profile PhotoSticknodes Laboratories sign ups [DEAD]Owner
  • Profile PhotoSticknodes Laboratories [DEAD]Owner
  • Profile Phototest groupOwner
  • Profile PhotoChicken LogsOwner
  • Profile PhotoCreatures SECRET shenanigans!!!Owner
  • Profile PhotoWeird dreamsOwner
  • Profile PhotoHorrific factsOwner
  • Profile Photo(dead group) Illustration club!Owner
  • Profile Photo(dead group) Weird imagesOwner
  • Profile PhotoCreatures unrelated shenanigansOwner
  • Profile Photocreatures forsaken shenanigansOwner
  • Profile PhotoSNC Private Groupadmin
  • Profile PhotoSticknodes’ Cataclysm, A Hopeless Voidadmin
  • Profile PhotoThe fun guy’s groupadmin
  • Profile PhotoOC land (golden)admin
  • Profile PhotoWildest Stickfigure Commentsmod
  • Profile PhotoSlugcatsmod
  • Profile PhotoSong of the day/Songs i likemod
  • Profile PhotoSticknodes: Into the Code | Private Chatmod
  • Profile PhotoSticknodes: Into the Code (a Sticknodes game)mod
  • Profile PhotoSG:FC Secret documentsmod
  • Profile PhotoPhoenic middle school Purgatorymod
  • Profile PhotoEvil >:]mod
  • Profile PhotoShin Godzilla: Failed Coagulant (Apocalypse AU)mod
  • Profile PhotoMJ and J companymod
  • Profile PhotoMafiosos’s lifemod
  • Profile PhotoSticknodes Rain World Groupmod
My Trophies (4/10)
  • People Love MeLocked
  • Cult LeaderLocked
  • Node SculptorNatalie's Honey Flask
  • Grace of DashLocked
  • DiscusstingLocked
  • ConsistentRalph's Hat
  • AddictedHeckray's Scarf
  • Lord of ThumbsLocked
  • FriendlyLB's Mech Legs
  • BababooeyLocked
  • Activity
  • Profile
  • Friends 145
  • Groups 144
  • Personal
  • Mentions
  • Favorites
  • Friends
  • Groups

  • Profile picture of The Creature

    The Creature commented 2 weeks, 1 day ago

    Replying to comment by: Wannabe OutlawGoy is a Hebrew and Yiddish word that translates to "nation

    ah, ok, thanks for the clarification.

    0
      View
    • Profile picture of The Creature

      The Creaturesubscriberocciferfeatured-lvl1uc-winner-lvl2pro-noder 2 weeks, 1 day ago

      10
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Millie πŸ³οΈβ€πŸŒˆ
      • Logan-Zilla
      • Arambourgiania
      • Royal Nation Geist
      • Trolloner
      • Stickguy
      • Clvn
      • FizzyTheGreat
      • 𝓠𝙾①①乂(ZeMSMRigger)πŸ³οΈβ€πŸŒˆ
      • Profile picture of Trolloner
        Trolloner · 2 weeks, 1 day ago

        This is music to my ears

        2026-06-03 00:58:57 UTC 5
        • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
        • Logan-Zilla
        • FizzyTheGreat
        • Arambourgiania
        • The Creature
    • Profile picture of The Creature

      The Creaturesubscriberocciferfeatured-lvl1uc-winner-lvl2pro-noder 2 weeks, 1 day ago

      Sticknodes’ Cataclysm, A Hopeless Void Sticknodes’ Cataclysm, A Hopeless Void


      10
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Millie πŸ³οΈβ€πŸŒˆ
      • Legend
      • Arambourgiania
      • Stickguy
      • Insanessed
      • Royal Nation Geist
      • Kagamine Len (ZeMSMRigger) πŸ³οΈβ€πŸŒˆ
      • Clvn
      • FizzyTheGreat
      • Profile picture of Trolloner
        Trolloner · 2 weeks, 1 day ago

        Sticknodes cacacacacacacacacacacaaaaaagafaggahshwheh

        2026-06-02 23:27:44 UTC 5
        • Arambourgiania
        • Golden//Ralsei
        • Stickguy
        • Insanessed
        • FizzyTheGreat
        • Profile picture of Gleepgloop
          Gleepgloop · 2 weeks ago
          Replying to: TrollonerSticknodes cacacacacacacacacacacaaaaaagafaggahshwheh

          Relatable

          2026-06-03 10:03:40 UTC 1
          • FizzyTheGreat
    • Profile picture of The Creature

      The Creature commented 2 weeks, 1 day ago

      Replying to comment by: Wannabe Outlaw
      40292_0-54719900-1780440120_screenshot_202606

      isn’t this derogatory
      just asking because it feels like it is

      1
      • Kagamine Len (ZeMSMRigger) πŸ³οΈβ€πŸŒˆ
      View
    • Profile picture of The Creature

      The Creaturesubscriberocciferfeatured-lvl1uc-winner-lvl2pro-noder 2 weeks, 1 day ago

      Nodeflow Network Nodeflow Network

      WAKE UP NEW STOMACH BOOK SONG DROPPED

      6
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Millie πŸ³οΈβ€πŸŒˆ
      • Stickguy
      • FizzyTheGreat
      • Kagamine Len (ZeMSMRigger) πŸ³οΈβ€πŸŒˆ
      • Clvn
    • Profile picture of The Creature

      The Creature commented 2 weeks, 1 day ago

      Replying to comment by: GleepgloopLet him in >:(

      he’s already in

      2
      • FizzyTheGreat
      • Clide Theodore collecterite
      View
    • Profile picture of The Creature

      The Creaturesubscriberocciferfeatured-lvl1uc-winner-lvl2pro-noder 2 weeks, 1 day ago

      what



      9
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Millie πŸ³οΈβ€πŸŒˆ
      • FizzyTheGreat
      • πŸ”οΈπŸŒ²BootlegsnakeπŸŒ²πŸ”οΈ
      • Kagamine Len (ZeMSMRigger) πŸ³οΈβ€πŸŒˆ
      • Stickguy
      • Clvn
      • Legend
      • Clide Theodore collecterite
      • Profile picture of Gleepgloop
        Gleepgloop · 2 weeks, 1 day ago

        Let him in >:(

        2026-06-02 20:24:35 UTC 3
        • FizzyTheGreat
        • Stickguy
        • Clide Theodore collecterite
        • Profile picture of The Creature
          The Creature · 2 weeks, 1 day ago
          Replying to: GleepgloopLet him in >:(

          he’s already in

          2026-06-02 20:39:53 UTC 2
          • FizzyTheGreat
          • Clide Theodore collecterite
          • Profile picture of Gleepgloop
            Gleepgloop · 2 weeks, 1 day ago
            Replying to: The Creaturehe’s already in

            YAYYYYY

            2026-06-02 20:56:32 UTC 1
            • Clide Theodore collecterite
      • Profile picture of Clide Theodore collecterite
        Clide Theodore collecterite · 2 weeks, 1 day ago

        Friend shaped

        2026-06-02 20:25:45 UTC 3
        • FizzyTheGreat
        • The Creature
        • Stickguy
      • Profile picture of FizzyTheGreat
        FizzyTheGreat · 2 weeks, 1 day ago

        What the fuck am I looking at β€”___β€”

        2026-06-02 20:50:27 UTC 1
        • Clide Theodore collecterite
    • Profile picture of The Creature

      The Creature commented 2 weeks, 1 day ago

      Replying to comment by: The Creaturehttps://youtu.be/7qqUHdLAX-8?si=Mq1gv83BSCHAOX6B https://you

      I love how Do You Like Air Conditioning sounds like the complex trying to make what it considers β€œhuman music” but it comes out as flawed and erratic

      5
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Stickguy
      • Clide Theodore collecterite
      • FizzyTheGreat
      • TheGoofyOfOzz
      View
    • Profile picture of The Creature

      The Creaturesubscriberocciferfeatured-lvl1uc-winner-lvl2pro-noder 2 weeks, 1 day ago

      Nodeflow Network Nodeflow Network


      8
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Millie πŸ³οΈβ€πŸŒˆ
      • Stickguy
      • Clide Theodore collecterite
      • FizzyTheGreat
      • TheGoofyOfOzz
      • Clvn
      • Kagamine Len (ZeMSMRigger) πŸ³οΈβ€πŸŒˆ
      • Profile picture of The Creature
        The Creature · 2 weeks, 1 day ago

        I love how Do You Like Air Conditioning sounds like the complex trying to make what it considers β€œhuman music” but it comes out as flawed and erratic

        2026-06-02 19:24:34 UTC 5
        • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
        • Stickguy
        • Clide Theodore collecterite
        • FizzyTheGreat
        • TheGoofyOfOzz
    • Profile picture of The Creature

      The Creature commented 2 weeks, 1 day ago

      Replying to comment by: πŸ³οΈβ€βš§οΈ Firedragon (she/they)But then your stomach acid would destroy it and end the chal

      yummy

      4
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Clide Theodore collecterite
      • Stickguy
      • Kagamine Len (ZeMSMRigger) πŸ³οΈβ€πŸŒˆ
      View
    • Profile picture of The Creature

      The Creature commented 2 weeks, 1 day ago

      Replying to comment by: Avarice010Y'all, you get $10,000 dollars a week, but you have to choo

      I’d eat it

      4
      • Clide Theodore collecterite
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • Legend
      • Stickguy
      View
    • Profile picture of The Creature

      The Creaturesubscriberocciferfeatured-lvl1uc-winner-lvl2pro-noder 2 weeks, 1 day ago



      11
      • Stickguy
      • Molly Prime
      • Legend
      • FizzyTheGreat
      • ΰΌ»π“Šˆπ’†œππ¨πœπ­π²π«πšπ’†œπ“Š‰ΰΌΊ
      • Phoenic
      • 𝓠𝙾①①乂(ZeMSMRigger)πŸ³οΈβ€πŸŒˆ
      • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
      • β˜„οΈπŸ’« EvoGodzilla 343 πŸ’«β˜„οΈ
      • Lawyer!?β„ 
      • Insanessed
      • Profile picture of ~⭐ Rei ⭐~
        ~⭐ Rei ⭐~ · 2 weeks, 1 day ago


        2026-06-02 12:36:03 UTC 5
        • The Creature
        • Stickguy
        • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
        • Lawyer!?β„ 
        • Kagamine Len (ZeMSMRigger) πŸ³οΈβ€πŸŒˆ
      • Profile picture of Molly Prime
        Molly Prime · 2 weeks, 1 day ago

        I’m so scared right now

        2026-06-02 15:46:02 UTC 2
        • The Creature
        • Stickguy
    • Profile picture of The Creature

      The Creature commented 2 weeks, 1 day ago

      Replying to comment by: TynamoRookie numbers Last time I checked my mods it was over 1500

      my computer (windows 10 model, windows 11 system) would just kill itself if it reached that number of mods

      0
        View
      • Profile picture of The Creature

        The Creature commented 2 weeks, 2 days ago

        Replying to comment by: The Creatureabout to beat chapter 5 just watched huggy get atomized [bp

        ice bucket challenge ☺️☺️☺️❤️❤️❤️❤️
        IMG 4371

        3
        • β˜„οΈπŸ’« EvoGodzilla 343 πŸ’«β˜„οΈ
        • Stickguy
        • πŸ³οΈβ€βš§οΈ Firedragon (she/they)
        View
      • Profile picture of The Creature

        The Creature commented 2 weeks, 2 days ago

        Replying to comment by: LegendSaddest horror movie scene oat bro Then they gonna do the re

        …movie??

        2
        • Legend
        • Stickguy
        View
      • Load More

      Random Ass Poll

      Let's bring back a classic, are you:

      View Results

      Loading ... Loading ...
      Poll Archive

      • Profile Photo𝓠𝙾①①乂(ZeMSMRigger)πŸ³οΈβ€πŸŒˆ
      • Profile PhotoProject Sticknodes
      • Profile PhotoRoyal Nation Geist
      • Profile PhotoFizzyTheGreat
      • Profile PhotoFizzyTheGreat
      • Profile PhotoGleepgloop
      • Profile PhotoRoyal Nation Geist
      • Profile Photo𝓠𝙾①①乂(ZeMSMRigger)πŸ³οΈβ€πŸŒˆ
      • Iphone 17 Pro Max PackIphone 17 Pro Max Pack
      • The Weapons of Ultrakill MovieclipThe Weapons of Ultrakill Movieclip
      • Kit Bodega Movieclip 2Kit Bodega Movieclip 2
      • Kit Bodega MovieclipKit Bodega Movieclip

      What is Stick Nodes?

      Stick Nodes is a simple-but-powerful stickfigure animation app created for mobile devices. Easily create your own animations of moving stickfigures right on your Android, iPhone, or iPad!

      Easy for new animators but incredibly robust for more skilled users - the simplicity of Pivot with the power of Flash!

      The Pro version of Stick Nodes has extra functionality for sound effects, MP4 (video) exporting, no ads/watermark, and extra stickfigure filters (blur, glow, saturation, hue-shift, color-inversion, pixelation, and tint). It's a one-time payment, no IAP, and updates forever!

      Features for both Free/Pro versions include:

      • Import and animate images as well (sprites)!
      • Automatic customizable frame-tweening, make your animations smoother
      • A simple camera to pan/zoom/rotate around the scene, similar to the "v-cam" in Flash.
      • Movieclips allow you to create and reuse/loop animation objects within your projects.
      • A variety of shapes, color/scale on a per-segment basis, gradients - create any "stickfigure" you can imagine!
      • Textfields allow for easy text and speech in your animations.
      • Add all kinds of sounds effects to make your animations epic.
      • Apply different filters to your stickfigures - transparency, blur, glow, and more.
      • Join stickfigures together to easily simulate holding/wearing objects.
      • A large community full of all kinds of...interesting characters, and other animators.
      • Over 60,000+ stickfigures (and counting) to download from the website.
      • Export to GIF (or MP4 for Pro) to share your animation online.
      • Compatibility with pre-3.0 Pivot stickfigure files.
      • Save/open/share your projects, stickfigures, and movieclips.
      • And all the other typical animation stuff - undo/redo, onion-skin, tweening tools, and more!
      Stick Nodes Samsung Stick Nodes iPad

      Stick Nodes comes in a few languages as well:

      • English
      • EspaΓ±ol
      • FranΓ§ais
      • Japanese
      • Filipino
      • PortuguΓͺs
      • Russian
      • TΓΌrkΓ§e
      Stick Nodes

      Stick Nodes® ©2014 - 2026 Ralph Damiano of ForTheLoss Games, Inc.

      All rights reserved | TOS & Privacy Policy

      Powered by WordPress. Theme is DW Minion by DesignWall

      ©2021 RalphCo, Inc.